Mutatie, mutageen en DNA Repair

By | 17.07.2017

Mutatie, mutageen en DNA Repair Nucleotide excisie reparatie

Copyright 1998 door Beth A. Montelone, Doctoraat afdeling Biologie, Kansas State University.; oorspronkelijk geschreven als aanvulling op BIOL400, Human Genetics.

Mutatie, mutageen en DNA Repair Outline

We hebben het gebruik van de term ‘mutatie’ pretty losjes tot op dit punt in de loop. Nu moeten we het beter te omschrijven: mutation– een verandering in het genetisch materiaal (bijv. DNA). We gaan wat tijd besteden aan het praten over hoe mutaties kunnen plaatsvinden en wat de gevolgen kunnen zijn om cellen; We zullen ook kijken naar de manieren waarop de cellen voorkomen mutaties door het herstel van DNA-schade.

Waarom deze focus? Waarom zijn mutaties belangrijk? Er zijn verschillende redenen: 1) zij kunnen schadelijke of (zelden) gunstige effecten hebben aan een organisme (of zijn nakomelingen); 2) ze belangrijk zijn voor genetici: de meest voorkomende manier waarop we iets te bestuderen is om het te breken – dat wil zeggen. We zoeken of een variant (mutant) die het vermogen om een ​​proces dat we willen onderzoeken uitvoeren. Deze genetische varianten bezitten mutant allelen van de genen zijn we geïnteresseerd in het bestuderen. 3) Mutaties zijn belangrijk als de belangrijkste bron van genetische variatie die brandstoffen evolutionaire verandering (zoals we later zullen zien wanneer we het hebben over de bevolking genetica en evolutie).


Laten we mutatie verder te definiëren als een erfelijk verandering in het genetisch materiaal. Dit punt wordt belangrijk in meercellige organismen, waar we moeten onderscheid maken tussen veranderingen in geslachtscellen (kiemlijn mutaties) en veranderingen in het lichaam cellen (somatische mutaties). De eerstgenoemde worden doorgegeven aan iemands nageslacht; de laatste niet, maar we zullen zien dat ze kan zeer belangrijk zijn bij het ontstaan ​​van kanker.

Detectie van kiemlijn mutaties in mensen en meting van menselijke mutatie hebben wij het probleem van diploïdie. Meest vooruitgeschoven mutaties (normaal gen gemuteerde vorm) zijn recessief en zo zal niet worden gedetecteerd, tenzij een zygote krijgt twee kopieën van het gemuteerde allel. [Terugkeer of terugmutatieonderzoek (mutant terug naar normaal) is over het algemeen veel minder frequent, want er zijn veel meer manieren om "breken" een gen dan zijn er om een ​​bestaande mutatie te keren.] Dus hoe kunnen we detecteren en meten de tarieven van de nieuwe mutaties? We kunnen kijken naar dominante mutaties op zich voordoen op de autosomen en zowel recessieve en dominant mutaties op het X-chromosoom, aangezien mannetjes zijn hemizygoot voor X-gebonden genen. Voorbeeld: achondroplasie sporadisch (in families zonder voorgeschiedenis) als gevolg van nieuwe mutaties in het gen voor fibroblast groeifactor receptor. Een studie ontdekte zeven baby’s geboren met sporadische achondroplasie in een jaar onder de 242.257 in totaal geboorten geregistreerd. Zodat het percentage (in feite een frequentie, maar we zullen niet bezorgd over het verschil in het kader van het denken over de tarieven in deze cursus zijn) is 7 / 242.257 x 1/2 (2 allelen per zygote) = 1,4 x 10e-5.

Dit tarief is ongeveer in het midden van de range gerapporteerd voor verschillende menselijke genen: die met hoge mutation tarieven zoals NF1 (neurofibromatose type 1) en DMD (Duchenne spierdystrofie) (ca. 1 x 10e-4) en mensen met lage tarieven van nieuwe mutatie, zoals de Ziekte van het Huntington-gen (1 x 10e-6). Dit honderdvoudig range toont aan dat mutatie tarieven per gen intrinsiek verschillend kan zijn.

Waarom zou dit zijn? Twee mogelijke verklaringen zijn: 1) beoogde omvang en 2) hot spots. Sommige genen zijn groot, wat betekent dat er veel basen waarbij mutaties kunnen veranderen of de functies verstoren. Het grote doel argument zou wel eens verantwoordelijk voor de hoge tarieven van de mutatie van het NF en DMD-genen, omdat deze is bekend dat ze zeer grote eiwit-coderende regio’s. Als alternatief kunnen sommige genen in gebieden van chromosomen die gevoeliger zijn voor genetische schade / verandering of kunnen sequenties die vaker worden veranderd door spontane mutaties bevatten; de achondroplasie gen bekend een hot spot laatstgenoemde categorie (a CpG sequentie, hieronder besproken) bevatten.

Uit studies als deze in vivo en anderen met menselijke cellen in vitro, is de totale menselijke mutatie geschat ongeveer 1 x 10e-6 per gen per generatie. (Dus het HD gen bedraagt ​​waarschijnlijk meer typisch dan de hier genoemde genen.) Dit percentage is vergelijkbaar met die gemeten in diverse prokaryotische en eukaryotische organismen. We kunnen de geschatte menselijke mutatie tarief te gebruiken om de impact ervan op de waarschijnlijkheid van veranderingen in elke generatie te bepalen: een tarief van 1 x 10e-6 mutaties / gen x 5 x 10E4 genen / haploïde genoom = 5 x 10e-2 mutaties per gameet (= 5/100 of 1/20). 1/20 x 2 gameten per zygote = 10/01 kans dat elk zygote draagt ​​een nieuwe mutatie ergens in het genoom. Dit lijkt een zeer groot aantal, maar we moeten niet vergeten dat de meeste mutaties zijn recessief en zal dus niet worden uitgedrukt in de heterozygote toestand.

Mutaties of erfelijke veranderingen in het genetische materiaal kan gross (ter hoogte van het chromosoom dat we reeds hebben besproken) of bijzondere aanpassingen (dit betekent technisch mutaties niet zichtbaar cytologische abnormaliteiten en / of verzoeken toegewezen aan één "punt" in experimentele kruisingen). Deze kan slechts een enkele nucleotide pair in DNA. In deze sectie zullen we overwegen kleine veranderingen in het DNA van de puntmutatie type.

A. Basepaar (nucleotide paar) substituties

Dit zijn twee types: overgangen (Purine naar purine- of pyrimidine pyrimidine) en transversies (Purine tot pyrimidine of purine pyrimidine). We breken deze naar beneden in de twee categorieën omdat ze kan op verschillende manieren.

De gevolgen van base substitutie mutaties in voor eiwit coderende gebieden van een gen zijn afhankelijk van de substitutie en de locatie. Zij kunnen stil. niet resulteert in een nieuwe aminozuur in het eiwit sequentie, bijv. GCA GCG of codons in mRNA beide betekenen arginine [dit is vaak het geval in de derde positie van een codon, vooral vanwege overgangen "wiebelen" baseparing]. Een base substitutie kan ook resulteren in een aminozuur substitutie; Dit wordt aangeduid als een missense mutatie. Bijvoorbeeld CTC in het DNA sense streng [GAG mRNA] een glutamaatresidu in het eiwit specificeren; dit is gewijzigd CAC in de DNA of GUG in het mRNA, resulterend in een valine residu in de beta-globine eiwitketen veroorzaakt sikkelcelanemie. Missense mutaties kan ernstige gevolgen, hebben, zoals bij sikkelcelanemie, mild gevolgen zoals in het geval van hemoglobine C (een ander aminozuur substitutie op positie 6 van beta-globine) of geen fenotype bij twee bekend aminozuursubstituties op positie 7 van beta-globine. Tenslotte kunnen base substituties in een eiwit coderend gebied een aminozuur codon een terminatiecodon of vice versa muteren. Het eerste type, waardoor een voortijdig verkorte eiwit wordt aangeduid als een onzin mutatie. De effecten van nonsense mutaties zijn variabel, afhankelijk van hoeveel van het afgeknotte eiwit aanwezig is en nodig is voor zijn functie.

Base substitutie mutaties kan zich ook voordoen in promotors of 5 ‘regulerende gebieden van genen of introns en kunnen hun transcriptie, translatie, of splicing beïnvloeden. Veel van de beta-thalassemie zijn het resultaat van deze soorten niet-structurele mutaties die het niveau van expressie van de globine genen beïnvloeden. Alle soorten mutatie bovenbeschreven waargenomen in menselijke globine genen. De gevolgen afhangen van wat ze doen om het niveau van expressie van het genproduct en / of op welke aminozuursubstitutie zijn opgetreden en indien het in het eiwit.

B. Frameshift mutaties

Dit resultaat van de insertie of deletie van één of meer (niet in veelvouden van drie) nucleotiden in het coderende gebied van een gen. Dit veroorzaakt een wijziging van het leesraam: sinds codons groepen van drie nucleotiden, zijn er drie mogelijke leesramen voor elk gen hoewel slechts één wordt gebruikt.

bijv. mRNA met sequentie AUG CAG AUA AAC GCU GCA UAA
aminozuurvolgorde uit de eerste lezing kader: met Gin ile ASN ala ala stoppen
de tweede reading frame geeft: cys arg stop

Een mutatie van dit soort wijzigingen alle aminozuren stroomafwaarts en is zeer waarschijnlijk een functioneel product aangezien daartegen aanzienlijk kunnen afwijken van het normale eiwit. Verder, behalve de juiste leesramen bevatten vaak stopcodons die het mutante eiwit voortijdig afkappen.

A. Definitie en bronnen

Een spontane mutatie die optreedt als gevolg van natuurlijke processen in cellen. We kunnen deze onderscheiden van geïnduceerde mutaties; die welke het gevolg zijn van de interactie van DNA met een buiten agent of mutageen. Omdat een aantal van dezelfde mechanismen die betrokken zijn bij de productie van spontane en geïnduceerde mutaties, zullen we ze samen beschouwen. Sommige zogenaamde "spontane mutaties" waarschijnlijk het gevolg van natuurlijk voorkomende mutagenen in het milieu; Toch zijn er anderen die zeker spontaan ontstaan, bijvoorbeeld DNA-replicatie fouten.

B. DNA-replicatie fouten en nauwkeurigheid polymerase

Fouten in DNA-replicatie wanneer een onjuist nucleotide wordt toegevoegd zal leiden tot een mutatie in de volgende ronde van DNA-replicatie van de streng met de onjuiste nucleotide.The frequentie waarmee een DNA- polymerase fouten maakt (voegt een incorrecte base) de spontane mutatie beïnvloeden frequentie en het is waargenomen dat verschillende polymerases variëren in de nauwkeurigheid daarvan. Een belangrijke factor voor de nauwkeurigheid polymerase is de aanwezigheid van een "correctie" 3′-5 ‘exonuclease die verkeerd gepaarde basen ingevoegd bij de polymerase zal verwijderen. Dit werd aangetoond in vitro met gezuiverd DNA polymerasen (die met 3′-5 ‘exonucleasen minder fouten) en genetisch door Drake met bacteriofaag T4 mutanten: T4 heeft een eigen polymerase met 3′-5’ exo. Drake geïsoleerd mutator mutanten (die een hogere spontane mutatie snelheid dan normaal gehad) en antimutator mutanten (lagere mutatie dan normaal) in het polymerase-gen en bleek dat de mutators een hogere verhouding polymeriseren tot exonuclease activiteit dan normaal en dat antimutators een lagere verhouding. Deze studies toonden aan dat de functie van de 3′-5 ‘exonuclease om verkeerde incorporatie in DNA-replicatie te voorkomen en om mutaties te voorkomen. Mutator mutanten sindsdien geïsoleerd in andere organismen en is aangetoond dat verschillende onderdelen van de DNA-replicatie complex beïnvloeden; veranderingen in een aantal van deze eiwitten waarschijnlijk een nauwkeurigheid van het systeem beïnvloeden.

C. Base wijzigingen en base schade

De basis van DNA zijn onderhevig aan spontane structurele veranderingen genoemd tautomerisatie. ze kunnen bestaan ​​in twee vormen waartussen zij interconversie. Zo kan guanine bestaan ​​keto en enol vorm. De keto vorm heeft de voorkeur maar de enolvorm kan plaatsvinden door het verschuiven van een proton en een aantal elektronen; deze vormen worden tautomeren of structurele isomeren genoemd. De verschillende tautomere vormen van de bases hebben verschillende eigenschappen koppelen. Thymine kan ook een enol vorm; adenine en cytosine bestaan ​​amino- of iminogroep vormen. Indien tijdens DNA-replicatie, G in de enolvorm, de polymerase zal een T tegenover het in plaats van de normale voeg C omdat de baseparende voorschriften worden gewijzigd (geen polymerase fout). Het resultaat is een G: C A: T transitie; tautomerisatie veroorzaakt alleen overgang mutaties.

Andere mutatgenic dat plaatsvindt in cellen spontaan base afbraak. De deaminering van cytosine tot uracil gebeurt op een aanzienlijke snelheid in cellen.

Deaminering kunnen worden gerepareerd door een specifieke reparatie proces dat uracil, niet normaal aanwezig zijn in DNA detecteert; anders wordt de U veroorzaakt een er tegenover is geladen en veroorzaken C: G naar T: A overgang wanneer het DNA gerepliceerd.

Deaminering van methylcytosine thymine kunnen ook optreden. Methylcytosine voorkomt in het menselijk genoom in de volgorde 5’CpG3 ‘, die normaal voorkomen in de coderende gebieden van genen. Als de MEC gedeamineerd naar T, er geen reparatiesysteem dat kan herkennen en verwijderen (omdat T is een normale basis van DNA). Dit betekent dat waar CpG optreedt in genen is een "hot spot" voor mutatie. Dergelijke hot spot is onlangs gevonden in de achondroplasie gen.

Een derde type spontane DNA schade die vaak voorkomt schade aan de basis van vrije radicalen van zuurstof. Deze ontstaan ​​in cellen als gevolg van oxidatieve metabolisme en ook gevormd worden door fysische middelen zoals straling. Een belangrijke oxydatie product 8-hydroxyguanine die mispairs met adenine, wat resulteert in G: C tot T: A transversies.

Nog een ander type spontane DNA schade alkylering. de toevoeging van alkyl (methyl, ethyl, propyl af) aan de basen toe of skelet van DNA. Alkylering kan plaatsvinden door reactie van verbindingen zoals S-adenosylmethionine met DNA. Gealkyleerde basen kunnen worden onderworpen aan spontane storing of mispairing.

D. Spontane frameshift mutaties

Streisinger waargenomen in 1960 dat frameverschuiving mutaties in bacteriofagen neiging om in gebieden met "runs" herhalingen van één nucleotide.

Voorbeeld:
5 ‘AGTCAATCCATGAAAAAATCAG 3’
3 ‘TCAGTTAGGTACTTTTTTAGTC 5’

Hij stelde dat deze frameshifts het gevolg zijn van "gleed mispairing" tussen het matrijs-DNA-streng en de nieuw gesynthetiseerde streng tijdens DNA replicatie. In bovenstaande stappen, zou een waarschijnlijke plek voor frameshift mutaties optreden in het traject van 6 A: T basenparen. Daaropvolgende studies met genen van andere organismen, waaronder mensen, hebben aangetoond dat loopt van herhaalde nucleotiden inderdaad hotspots frameshift mutaties.

Een mutagene een natuurlijk of door de mens gemaakte agens (fysisch of chemisch) die de structuur of sequentie van DNA kunnen veranderen.

A. Chemische mutagenen

De eerste melding van mutagene werking van een chemische stof werd in 1942 door Charlotte Auerbach, die aantoonde dat stikstofmosterd (component giftige mosterdgas gebruikt in Wereldoorlog I en II) mutaties in cellen kunnen veroorzaken. Sinds die tijd zijn er veel andere mutagene stoffen zijn geïdentificeerd en er is een enorme industrie en overheidsbureaucratie gewijd aan het vinden van hen in levensmiddelenadditieven, industrieel afval, enz.

Het is mogelijk om chemische mutagenen te onderscheiden door hun werkingswijze; sommige mutaties veroorzaakt door mechanismen die vergelijkbaar zijn met die welke spontaan terwijl anderen meer straling (beschouwd volgende) in hun effecten.

1. Base analogen

Deze chemicaliën structureel lijken purinen en pyrimidinen en in DNA worden ingebouwd in plaats van de normale basen in DNA-replicatie:

  • broomuracil (BU) – kunstmatig gecreëerde verbinding op grote schaal gebruikt in het onderzoek. Lijkt thymine (heeft Br atoom in plaats van methylgroep) en in DNA en een paar zal worden opgenomen met A als thymine. Het heeft een hogere kans om tautomerisatie de enolvorm (BU *)
  • aminopurine –adenine analoog die kan koppelen met T of (minder goed) met C; oorzaken A: T naar G: C of G: C A: T overgangen. Base-analogen veroorzaken overgangen, net als spontane tautomerisatie evenementen.

2. Chemische stoffen die de structuur en de paring eigenschappen van basen veranderen

Er zijn veel van dergelijke mutageen; enkele bekende voorbeelden zijn:

  • salpeterigzuur –gevormd door digestie van nitrieten (conserveermiddelen) in levensmiddelen. Het veroorzaakt C tot U, MEC T en A deaminations hypoxanthine. [Zie hierboven voor de gevolgen van de eerste twee gebeurtenissen; hypoxanthine DNA in paren met C en veroorzaakt overgangen. Deaminering door salpeterigzuur, zoals spontane deaminering, veroorzaakt overgangen.
  • nitrosoguanidine, methaansulfonaat methyl, ethyl methaansulfonaat –chemische mutagenen die reageren met basen en voeg methyl- of ethylgroepen. Afhankelijk van het betrokken atoom, kan het gealkyleerde base dan degraderen ongegronde site die mutageen en recombinogene of mispair leiden tot mutaties op DNA-replicatie verkregen.

3. intercalerende middelen

acridine oranje, proflavin ethidiumbromide (Gebruikt in laboratoria als kleurstoffen en mutagene stoffen)

Alle zijn plat, verschillende ring moleculen die interageren met basen van DNA en plaats daartussen. Dit veroorzaakt een insertie "uitrekken" van de DNA duplex en de DNA polymerase "voor de gek houden" in het invoegen van een extra base tegenover een ingelaste molecuul. Het resultaat is dat intercalerende middelen veroorzaken frameshifts.

4. Agenten veranderen DNA-structuur

We gebruiken dit als een "catch-all" categorie die een verscheidenheid aan verschillende middelen omvat. Deze kunnen zijn:

  • –grote moleculen die binden aan DNA-basen en zullen hen coderende – we verwijzen naar deze als "omvangrijk" laesies (bijv. NAAAF )
  • –agenten waardoor intra- en inter-streng crosslinks (bv. psoralenen –in sommige groenten en gebruikt in behandeling van bepaalde huidaandoeningen)
  • –chemicaliën waardoor DNA-breuken (bv. peroxiden )

Wat deze middelen met elkaar gemeen hebben, is dat ze waarschijnlijk mutaties veroorzaken niet rechtstreeks, maar door inductie van mutagene herstelprocessen (later te beschrijven).

B. Radiation

Straling was de eerste mutagene stof bekend is; de effecten van genen werden voor het eerst gerapporteerd in 1920. Straling zelf werd ontdekt in 1890: Röntgen ontdekt X-stralen in 1895, Becquerel ontdekt radioactiviteit in 1896, en Marie en Pierre Curie ontdekte radioactieve elementen in 1898. Deze drie ontdekkingen en anderen leidde tot de geboorte van de atoomfysica en ons begrip van elektromagnetische straling .

1. EM spectrum

Zichtbaar licht en andere straling zijn alle soorten elektromagnetische straling (uit elektrische en magnetische golven). De lengte van elektromagnetische golven (golflengte) varieert sterk en is omgekeerd evenredig met de energie die zij bevatten: dit is de basis van de zogenaamde EM spectrum.

De langste golven (AM-radio) hebben de minste energie, terwijl achtereenvolgens kortere golven en de stijgende energieprijzen worden gezien met FM-radio, TV, microgolven, infrarood, zichtbaar, ultraviolet (UV), X en gammastraling. Het gedeelte dat biologisch significant is UV straling en hogere energiekosten.

2. Ioniserende straling

X- en gammastralen energiek genoeg dat zij produceren reactieve ionen (geladen atomen of moleculen) wanneer zij reageren met biologische moleculen; daarom worden ze aangeduid als ioniserende straling. Deze term omvat ook lichaamsstraling – stromen van atomaire en subatomaire deeltjes uitgezonden door radioactieve elementen: dit zijn twee soorten, alfa- en bèta-deeltjes [alpha zijn heliumkernen, 2 protonen en 2 neutronen; beta zijn elektronen].

UV straling wordt geen ioniserende maar kan reageren met DNA en andere biologische moleculen en is ook belangrijk als mutageen.

De eenheden nu gebruikt voor ioniserende straling van alle soorten zijn Rems (röntgen-equivalent man): 1 rem van elke ioniserende straling produceert vergelijkbare biologische effecten. De eenheid eerder gebruikte was rad (geabsorbeerde stralingsdosis). De effecten van verschillende soorten straling verschillen één rad eenheid: een rad alfadeeltjes een veel groter schadelijk effect dan een rad gammastralen; alfa-deeltjes hebben een grotere RBE (relatieve biologische doeltreffendheid) dan gammastralen. De relatie tussen deze eenheden is dat:

# Rad x RBE = # rems

Naast het soort energie en de totale stralingsdosis het dosistempo worden overwogen: evenveel rem gegeven in een korte, intense blootstelling (hoge dosis) veroorzaakt brandwonden en huidbeschadiging versus langdurige zwakke belichting (lage dosis rate) die enkel risico van mutatie en kanker zou toenemen.

3. Bronnen straling

Natuurlijke bronnen van straling zogenaamde achtergrondstraling. Deze omvatten kosmische stralen van de zon en de ruimte, radioactieve elementen in de bodem en terrestrische producten (hout, steen) en in de atmosfeer (radon). Iemands blootstelling te wijten aan achtergrondstraling varieert met de geografische locatie.

Bovendien hebben mensen kunstmatige stralingsbronnen die bijdragen aan onze stralingsblootstelling gemaakt. Onder deze zijn medische testen (diagnostische X-stralen en andere procedures), het testen en kerncentrales, en diverse andere producten (TV’s, rookmelders, luchthaven X-stralen).

Bij elkaar genomen, onze algehele totale gemiddelde blootstelling uit alle bronnen is ongeveer 350 mrem / jaar; de grootste bijdrage waarvan uit radonblootstelling. Zie de grafiek op pagina 281 van de tekst voor de afbraak.

4. Biologische effecten van straling

Ioniserende straling produceert een reeks schade aan cellen en organismen voornamelijk door de productie van vrije radicalen water (de hydroxylgroep of OH groep). Vrije radicalen bezitten ongepaarde elektronen en zijn chemisch zeer reactief en interactie met DNA, proteïnen, lipiden in celmembranen, etc. Dus Röntgenstralen kunnen DNA en eiwit schade die kan leiden tot falen organel, blok celdeling of celdood veroorzaken veroorzaken . De snel delende celtypen (bloedcellen vormende gebieden van beenmerg, maagdarmkanaal voering) zijn de meest getroffen door ioniserende straling en de ernst van de effecten afhankelijk van de ontvangen dosis. Onderstaande informatie is gebaseerd op accidentele blootstelling van de kerncentrale werknemers en slachtoffers van de atoombom explosies zoals die in Hiroshima en Nagasaki:

subletale dosis (100-250 rem): misselijkheid en braken begin; 1-2 week. latente periode gevolgd door malaise, anorexia, diarree, haaruitval, herstel (latency wijten aan de tijd die nodig is hematopoetic of andere schade te laten zien)

dodelijke dosis (350-450 rem): misselijkheid en braken begin; 1 week. latente periode gevolgd door bovenstaande met meer ernstige symptomen, waaronder interne bloeden; een sterftekans [LD50 50%. dosis waarbij de helft van de blootgestelde personen zullen sterven; ca. 400 rem voor de mens]. Dood door bloedcel of gastrointestinale falen.

supralethal dosis (Gt; 650 rem) misselijkheid en braken begin, gevolgd door schok, buikpijn, diarree, koorts en dood binnen uren of dagen. De dood is te wijten aan hart of CNS schade.

Voor de aangetaste weefsels en organen, het aantal vernietigde cellen en de waarschijnlijkheid dat deze vervanging bepaalt de overlevingskansen. De lange termijn effecten omvatten verhoogde risico op kanker en een verhoogd risico van mutaties in zijn nageslacht.

5. Genetische stralingseffecten

ioniserende straling produceert een scala aan effecten op DNA, zowel door middel van vrije radicalen effecten en directe actie:

  • -onderbrekingen in een of beide strengen (kan leiden tot herschikkingen, deleties, chromosoomverlies, de dood als unrepaired, dit is van stimulatie van recombinatie)
  • -beschadiging / verlies van basen (mutaties)
  • -verknoping van DNA aan zichzelf of proteïnen

De genetische effecten van straling werden gemeld in 1927 in Drosophila door Muller en in 1928 in planten (gerst) van Stadler; in beide gevallen werd de frequentie van geïnduceerde mutaties is een functie van röntgendosis. Hun experimenten bleek dat er een lineair verband tussen dosis röntgenstraling en geïnduceerde mutatieniveau, dat er geen drempel of "veilig" stralingsdosis en dat alle doses significant, en ten slotte, dat "split dosis" experimenten toonden aan dat de genetische effecten van straling cumulatief zijn.

6. UV (ultraviolet)

UV straling minder energie, en derhalve niet-ioniserende, maar de golflengtes voorkeur geabsorbeerd door basen van DNA en aromatische aminozuren van eiwitten, zodat het ook heeft belangrijke biologische en genetische effecten.

UV is in principe ingedeeld in termen van de golflengte: UV-C (180-290 nm) -"kiemdodend"–most energiek en dodelijk is niet gevonden in zonlicht omdat het wordt geabsorbeerd door de ozonlaag; UV-B (290-320 nm) – belangrijke dodelijke / mutagene fractie van zonlicht; UV-A (320 nm – zichtbaar) -"in de buurt van UV"–also heeft nadelige effecten (vooral omdat het schept zuurstofradicalen), maar het produceert zeer weinig pyrimidine dimeren. Zonnebanken zal UV-A en UV-B. Om een ​​grafische weergave van de golflengten van UV en ozon absorptie te zien, klik hier.

De belangrijkste dodelijke letsels pyrimidine dimeren in DNA (geproduceerd door UV-B en UV-C) – deze het gevolg zijn van een covalente binding tussen aangrenzende pyrimidinen op één streng. Deze is hier voor een thymine-thymine dimeer en hier getoond voor een thymine-cytosine dimeer. Deze dimeren, zoals omvangrijke laesies van chemicaliën, blok transcriptie en DNA-replicatie en zijn dodelijk als niet herstelde. Ze kunnen mutatie en chromosoom omlegging eveneens stimuleren.

Omdat DNA schade optreedt spontaan en daardoor alomtegenwoordige milieu-invloeden, de meeste organismen bezitten enkele krachten met hun DNA herstel en DNA is de enige macromolecuul dat is hersteld door cellen. We kunnen verdelen "reparatie" mechanismen in 3 categorieën:

schade omkering –eenvoudigste; enzymatische werking herstelt de normale structuur zonder te breken ruggengraat

schade verwijderen –impliceert uitsnijden en het vervangen van een beschadigde of ongepaste base of deel van nucleotiden

damage tolerance –niet echt repareren, maar een manier van omgaan met de schade, zodat het leven kan gaan

We bekijken voorbeelden van elk type reparatie, de mechanismen, de gevolgen van mutaties in elk, zowel modelorganismen en bij mensen.

A. Schade omkering

1. fotoreactivering

Dit is een van de eenvoudigste en misschien oudste herstelsystemen: het bestaat uit een enzym dat pyrimidine dimeren (breek de covalente binding) kan splitsen in aanwezigheid van licht. Klik hier om de fotoreactivering reactie te zien.

De photolyase enzym katalyseert deze reactie; blijkt in veel bacteriën, lagere eukaryoten, insecten en planten. Het lijkt te zijn afwezig bij zoogdieren (waaronder de mens). Het gen is aanwezig in zoogdieren maar kan coderen voor een eiwit met een accessoire functie bij een ander type reparatie.

2. Ligatie van enkele breuken

X-stralen en een aantal chemische stoffen zoals peroxiden kunnen breuken in ruggengraat van DNA veroorzaken. Eenvoudige breuken in een streng worden snel hersteld door DNA-ligase. Microbiële mutanten ontbreekt ligase brengen hoge niveaus van recombinatie sindsdien DNA uiteinden recombinogenisch (zeer reactief). Een menselijke alleen bekend onder de codenaam 46BR bleek mutaties in haar beide DNA ligase I genen; ze had een slechte groei, immunodeficiëntie, en zon gevoeligheid en stierf op jonge leeftijd van lymfoom. Fibroblastcellen van 46BR zijn gevoelig voor doding door DNA beschadigende middelen zoals ioniserende straling. Bovendien, de zeldzame erfelijke ziekte Bloom syndroom Ook andere manier is betrokken bij DNA ligase deficiëntie (hoewel het Bloom syndroom eiwit een DNA helicase); patiënten gekweekte cellen hoge niveaus van chromosoom afwijkingen en spontane mutatie.

B. Schade verwijderen

1. Base excisie reparatie

De beschadigde of ongepaste basis is van zijn suiker koppeling verwijderd en vervangen. Dit zijn glycosylase enzymen die de basis-suiker bond snijden. voorbeeld: uracil glycosylase –enzym dat uracil niet langer op DNA. Uracil niet verondersteld in DNA – kan optreden als RNA-primers bij DNA-replicatie niet wordt verwijderd of (waarschijnlijker) als cytosine wordt gedeamineerd (dit potentieel mutagene). Het enzym herkent uracil en snijdt de glyscosyl koppeling aan deoxyribose. De suiker wordt dan gesplitst en een nieuwe basis gebracht door DNA polymerase met de andere streng als een matrijs. Mutanten zonder uracil glycosylase spontane mutatie niveaus (C U is niet vast, wat leidt tot overgangen) verhoogd en zijn overgevoelig te doden en mutatie van salpeterigzuur (welke C veroorzaakt U deaminering).

Er zijn andere specifieke glycosylasen tot bepaalde DNA schade door bestraling en chemicaliën.

2. mismatch repair

Dit proces treedt op nadat DNA-replicatie als laatste "spellingscontrole" op de nauwkeurigheid. In E. coli, voegt een 100-1000-voudig nauwkeurigheid replicatie. Het wordt uitgevoerd door een groep van eiwitten die DNA kan scannen en zoeken naar verkeerd gepaarde basen (of ongepaarde basen) waarbij afwijkende afmetingen in de dubbele helix zal moeten worden uitgevoerd. De onjuiste nucleotide wordt verwijderd als onderdeel van een stukje en dan wordt de DNA polymerase een tweede poging om de juiste sequentie te krijgen.

Menselijke mismatch repair eiwitten zijn onlangs geïdentificeerd en zijn zeer vergelijkbaar met die van de prokaryote E coli en de eenvoudige eukaryote gist (dit is een oude uitvinding van cellen); mutaties blijken te zijn overgegaan in de kiemlijn van families met sommige vormen van erfelijke darmkanker (HPNCC ).

3. Nucleotide excisie reparatie

Dit systeem werkt op DNA schade die "omvangrijk" en creëert een blok aan DNA-replicatie en transcriptie (dus – UV-geïnduceerde dimeren en sommige soorten chemische adducten). Het erkent waarschijnlijk niet een specifieke structuur, maar een vervorming in de dubbele helix. Het mechanisme omvat splitsing van de DNA-streng die de schade door endonucleasen aan weerszijden van beschadiging, gevolgd door exonuclease verwijdering van een kort segment van het beschadigde gebied. DNA polymerase kan in het gat dat resulteert vullen. Excision reparatie is hier te zien.

Mutanten die defect in NER zijn geïsoleerd in veel organismen en gevoelig zijn voor het doden en mutagenese door UV en chemicaliën die werken als UV. Mensen met de erfelijke ziekte xeroderma pigmentosum zonlicht zijn gevoelig, ze hebben zeer hoge risico van huidkanker aan zon blootgestelde gebieden van het lichaam en hebben defecten in genen die homoloog zijn aan die welke voor NER in eenvoudige eukaryoten. NER mutanten in lagere organismen zijn UV-gevoelige en hebben niveaus van mutatie en recombinatie veroorzaakt door UV verhoogd (omdat ze niet in staat om de juiste NER methode gebruiken om pyrimidine dimeren te verwijderen zijn en moet mutageen of recombinogene systemen te gebruiken).

C. DNA-schade tolerance

Niet alle DNA-schade is of kan onmiddellijk worden verwijderd; een deel ervan kan nog een tijdje. Als een DNA-replicatievork tegenkomt DNA schade zoals een dimeer pyrimidine zal gewoonlijk fungeren als een blok voor verdere replicatie.

In eukaryoten, DNA replicatie initieert op meerdere locaties en in staat zijn om stroomafwaarts van een dimeer weer, waardoor een "kloof" enkelstrengs DNA gerepliceerd. De kloof is potentieel net zo gevaarlijk als niet meer dan de dimeer als de cel deelt. Dus er is een manier om de kloof door recombinatie met hetzij de andere homoloog of zuster chromatide herstellen – levert dit twee intacte dochtermoleculen, waarvan nog bevat het dimeer.

1. recombinationele (dochter streng gap) reparatie

Dit is een herstelmechanisme die recombinatie bevordert de dochter streng gap vast – geen dimeer – en is een manier om te gaan met de problemen van niet- coderende laesie volharden in DNA. De gebeurtenissen van recombinationele reparatie worden hier getoond. Dit type recombinationele reparatie is over het algemeen accuraat (hoewel het homozygoten van schadelijke recessieve allelen kan veroorzaken) en vereist een homoloog of zus chromatid. De producten van de menselijke borstkanker susceptibiliteitsgenen BRCA1 en BRCA2 betrokken kunnen zijn bij recombinatie reparatie met homologen van gist RAD51 en RAD52 genen.

Een tweede type recombinationele reparatie die vooral gebruikt om gebroken DNA reparatie uiteinden zoals veroorzaakt door ioniserende straling en chemische mutagenen soortgelijke maatregelen is de niet-homologe-end-joining reactie. Dit reparatiesysteem wordt ook gebruikt door B- en T-cellen van het immuunsysteem voor genetische herschikkingen nodig zijn voor hun functie. De Ku70, Ku80 en DNA-afhankelijke eiwitkinase eiwitten zijn nodig voor niet-homologe-uiteinden. Knaagdieren cellijnen met mutaties in deze genen zijn zeer gevoelig voor doding door ioniserende straling en gebrekkig immuunsysteem omlegging.

2. Mutagene reparatie (trans-laesie synthese)

Een alternatief scenario voor een DNA polymerase geblokkeerd op een dimeer om de specificiteit te wijzigen zodat elke nucleotide tegenover het dimeer kunnen invoegen en verder replicatie ("muteren of sterven" scenario). Zie de afbeelding. We weten dat dit kan gebeuren in bacteriën en dat het waarschijnlijk gebeurt in eukaryoten, hoewel het mechanisme niet goed begrepen. Dit is een reden waarom reparatie soms mutaties kunnen veroorzaken.

ataxie telangiectasia een menselijk autosomaal recessieve erfelijke ziekte die verscheidene gebreken waaronder ongeveer honderd-voudige toename in gevoeligheid kanker veroorzaakt. AT cellen van patiënten bij cultuur te laten zien afwijkingen waaronder spontane en-straling veroorzaakte chromosoom pauzes en de gevoeligheid voor het doden van X-stralen. (Ironisch, de patiënten vertonen ook extreme gevoeligheid voor doding door röntgen- doses beoogde therapeutische hun kankers.) Echter, op gekweekte cellen een defect in reparatie van X-ray schade aan hun DNA vertonen; plaats, in tegenstelling tot normale cellen, blijven ze hun DNA zelfs als het is beschadigd door röntgenstralen repliceren. Is het niet DNA schade herkennen en adequaat door het stopzetten van de celcyclus tot herstel kan optreden die leidt tot chromosoomafwijkingen en dood na röntgenbeeld het AT patiënten.

Het defect in AT is een in een celcyclus, een beslissingspunt die progressie regelt door de volgende fase van de celcyclus. Er zijn genetisch gecontroleerde checkpoints die de toegang tot een nieuw celcyclus (G0 tot G1 point) beslist, het besluit om de DNA (G1 tot en met S-punt) te repliceren, en de beslissing om te verdelen (G2 naar M-punt). Mutaties in het checkpoint genen kunnen leiden tot ongecontroleerde celgroei, dwz. kanker.

Hoewel op zichzelf is een zeldzame aandoening, is geschat dat de frequentie van heterozygoten met een AT mutatie ongeveer 1% van de bevolking. Deze personen hebben ook een hoger risico op kanker en tussenliggende straling gevoeligheid. Aldus kan screening door röntgenmethoden (bv. Mammografie) de kans op een AT heterozygote kanker toeneemt.

Referenties voor meer informatie

Wat is DNA-herstel? De website van de NIH
"Het was een zeer goed jaar voor DNA-reparatie", J. E. Cleaver, Cell 76: 1-4, 1994.
"Molecule van het jaar: de DNA-reparatie-enzym", D. E. Koshland, Science 266: 1925, 1994.
"DNA-herstel werkt haar weg naar de top", E. Culotta en D. E. Koshland, Science 266: 1926-1929, 1994.
Nieuwe colonkanker gen ontdekt", J. Marx, Science 260: 751-752, 1993.
Mismatch repair, genetische stabiliteit en kanker", P. Modrich, Science 266: 1959-1960, 1994.
E.C. Friedberg, "Xeroderma pigmentosum, syndroom van Cockayne’s, helicasen, en DNA-reparatie: wat is de relatie?", Cell 71: 887-889, 1992.
S. Buratowski, "DNA-reparatie en transcriptie: de verbinding helicase", Science 260: 37-38, 1993.
D. Bootsma en J. H. J. Hoeijmakers, "Betrokkenheid bij transcriptie", Nature 363: 114-115, 1993.
"DNA-herstel tot zijn recht komt", Science 266: 728-730, 1994
A. Sancar, "Mechanismen van DNA-excisie reparatie", Science 266: 1954-1956, 1994.
P. C. Hanawalt, "-Transcriptie-gekoppeld herstel en ziekten bij de mens", Science 266: 1957-1958, 1994.
J. F. Crow, "Hoeveel weten we over spontane menselijke mutatie tarieven?", Milieu en Moleculaire Mutagenese 21: 122-129, 1993. Laatst bijgewerkt op 14 juni 1999.

Bron: www-personal.ksu.edu

Geef een reactie

Het e-mailadres wordt niet gepubliceerd. Verplichte velden zijn gemarkeerd met *

een × een =